zeb1 oe zeb1  (Genechem)

Journal: Journal of Orthopaedic Surgery and Research

Article Title: ZEB1 regulates bone metabolism in osteoporotic rats through inducing POLDIP2 transcription

doi: 10.1186/s13018-022-03312-0

Figure Lengend Snippet: Primer sequences

Article Snippet: Well-grown murine macrophages RAW264.7 (SC-6003, American Type Culture Collection, Manassas, VA, USA) were infected with the constructed lentiviral vectors harboring oe-NC, oe-ZEB1, oe-POLDIP2 or sh-POLDIP2 (TTGGACTGACCTGACTATAAA) (all from VectorBuilder, Guangzhou, Guangdong, China).

Techniques:

Journal: Journal of Orthopaedic Surgery and Research

Article Title: ZEB1 regulates bone metabolism in osteoporotic rats through inducing POLDIP2 transcription

doi: 10.1186/s13018-022-03312-0

Figure Lengend Snippet: ZEB1 was poorly expressed in both postmenopausal osteoporotic patients and rats. A The heatmap analysis of differentially expressed genes in the GSE56815 dataset where BMD refers to bone mineral density. B Detection of ZEB1 expression in the blood of normal controls and OP patients by RT-qPCR (n = 40). C Detection of ALP, OPN and RUNX2 expression in bone tissues of sham- and OVX-treated rat by RT-qPCR. D Detection of TRAP expression in rat bone tissue by immunohistochemistry. E Assessment of bone content and structural changes in femoral tissues of rats by HE staining where bone trabeculae were labeled with red arrows and bone mass was labeled with green arrows. F – G Expression of ZEB1 in rat bone tissues at mRNA and protein levels by RT-qPCR ( F ) and Western blot ( G ). All data are represented as mean ± SD (n = 6 for rats in each group). Each experiment was performed three times independently. * p < 0.05, ** p < 0.01. Differences are tested using two-way ANOVA with Tukey’s post hoc test ( C ) and unpaired t -test ( B , D , F , G )

Article Snippet: Well-grown murine macrophages RAW264.7 (SC-6003, American Type Culture Collection, Manassas, VA, USA) were infected with the constructed lentiviral vectors harboring oe-NC, oe-ZEB1, oe-POLDIP2 or sh-POLDIP2 (TTGGACTGACCTGACTATAAA) (all from VectorBuilder, Guangzhou, Guangdong, China).

Techniques: Expressing, Quantitative RT-PCR, Immunohistochemistry, Staining, Labeling, Western Blot

Journal: Journal of Orthopaedic Surgery and Research

Article Title: ZEB1 regulates bone metabolism in osteoporotic rats through inducing POLDIP2 transcription

doi: 10.1186/s13018-022-03312-0

Figure Lengend Snippet: ZEB1 supports osteoblast differentiation and restrains osteoclast differentiation. A Detection of mRNA expression of ZEB1 in bone tissues of rats in response to oe-NC or oe-ZEB1 by RT-qPCR. B Detection of protein expression of ALP, OPN and RUNX2 in bone tissues of rats by Western blot. C Immunohistochemical detection of OPG expression in bone tissues of rats. D Detection of mRNA expression of NFATC and CTSK in bone tissues of rats by RT-qPCR. E Immunohistochemical detection of TRAP expression in bone tissues of rats. F Assessment of bone content and structural changes in rat bone tissue by HE staining where bone trabeculae were labeled with red arrows and bone mass was labeled with green arrows. All data are represented as mean ± SD ( n = 6 for rats in each group). Each experiment was performed three times independently. * p < 0.05, ** p < 0.01. Differences are tested using two-way ANOVA with Tukey’s post hoc test ( B , D ) and unpaired t-test ( A , C , E )

Article Snippet: Well-grown murine macrophages RAW264.7 (SC-6003, American Type Culture Collection, Manassas, VA, USA) were infected with the constructed lentiviral vectors harboring oe-NC, oe-ZEB1, oe-POLDIP2 or sh-POLDIP2 (TTGGACTGACCTGACTATAAA) (all from VectorBuilder, Guangzhou, Guangdong, China).

Techniques: Expressing, Quantitative RT-PCR, Western Blot, Immunohistochemical staining, Staining, Labeling

Journal: Journal of Orthopaedic Surgery and Research

Article Title: ZEB1 regulates bone metabolism in osteoporotic rats through inducing POLDIP2 transcription

doi: 10.1186/s13018-022-03312-0

Figure Lengend Snippet: ZEB1 promotes the transcription of POLDIP2. A The intersection of top 50 downstream targets of ZEB1 in the hTFtarget database and significantly differentially expressed genes screened in the GSE56815 dataset. B Detection of expression changes of six intersecting genes in bone tissues of rats overexpressing ZEB1. C Conserved binding sites for ZEB1 predicted using JASPAR and potential binding sites of ZEB1 to POLDIP2 promoter. D POLDIP2 expression in the blood of normal controls and OP patients ( n = 40). E mRNA expression of POLDIP2 in bone tissues of sham- and OVX-treated rats by RT-qPCR. F mRNA expression of NFATC and CTSK in RAW264.7 cells infected with oe-NC or oe-ZEB1 after RANKL treatment by RT-qPCR. G Detection of mRNA expression of ZEB1 and POLDIP2 in RAW264.7 cells in response to oe-NC or oe-ZEB1 by RT-qPCR. H The enrichment ability of Anti-ZEB1 on POLDIP2 promoter in RAW264.7 cells in response to oe-NC or oe-ZEB1 by ChIP-qPCR. I Promoter luciferase activity of POLDIP2 examined in RAW264.7 cells in response to oe-NC or oe-ZEB1 using dual-luciferase assay. All data are represented as mean ± SD ( n = 6 for rats in each group). Each experiment was performed three times independently. * p < 0.05, ** p < 0.01, *** p < 0.001. Differences are tested using two-way ANOVA with Tukey’s post hoc test ( F , G ) and unpaired t -test ( D , E , H , I )

Article Snippet: Well-grown murine macrophages RAW264.7 (SC-6003, American Type Culture Collection, Manassas, VA, USA) were infected with the constructed lentiviral vectors harboring oe-NC, oe-ZEB1, oe-POLDIP2 or sh-POLDIP2 (TTGGACTGACCTGACTATAAA) (all from VectorBuilder, Guangzhou, Guangdong, China).

Techniques: Expressing, Binding Assay, Quantitative RT-PCR, Infection, Luciferase, Activity Assay

Journal: Journal of Orthopaedic Surgery and Research

Article Title: ZEB1 regulates bone metabolism in osteoporotic rats through inducing POLDIP2 transcription

doi: 10.1186/s13018-022-03312-0

Figure Lengend Snippet: Silencing of POLDIP2 attenuates the inhibitory effect of oe-ZEB1 on the differentiation of macrophages RAW264.7 to osteoclasts. RAW264.7 cells were infected with sh-NC, sh-POLDIP2, sh-NC + oe-NC, sh-NC + oe-ZEB1, sh-POLDIP2 + oe-NC or sh-POLDIP2 + oe-ZEB1. A mRNA expression of POLDIP2 and ZEB1 in cells after infection by RT-qPCR. B Detection of protein expression of OPG, NFATC and CTSK in cells after infection by Western blot analysis. C The protein expression of MMP9, c-Fos and Acp5 in cells after infection detected by Western blot analysis. All data are represented as mean ± SD. Each experiment was performed three times independently. * p < 0.05, ** p < 0.01. Differences are tested using two-way ANOVA with Tukey’s post hoc test

Article Snippet: Well-grown murine macrophages RAW264.7 (SC-6003, American Type Culture Collection, Manassas, VA, USA) were infected with the constructed lentiviral vectors harboring oe-NC, oe-ZEB1, oe-POLDIP2 or sh-POLDIP2 (TTGGACTGACCTGACTATAAA) (all from VectorBuilder, Guangzhou, Guangdong, China).

Techniques: Infection, Expressing, Quantitative RT-PCR, Western Blot